The reagent kit AmpligenBurk-mallei/pseudomallei-RT PCR is designed for detecting in vitro diagnostics and differentiate the DNA of glanders and melioidosis pathogens by real-time multiplex PCR in biological (clinical) material and cultures of microorganisms, as well as environmental objects and solid food products (rice). During clinical testing diagnostic value of reagent kit AmpligenBurk-mallei/pseudomallei-RT PCR has been studied.

ADAMTS15 Antibody
1-CSB-PA582168	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

ADAMTS15 Antibody
1-CSB-PA139279	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

ADAMTS15 Antibody
1-CSB-PA057722	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

ADAMTS15 Antibody
1-CSB-PA837445LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

ADAMTS15 Antibody
35644-100ul	SAB	100ul	EUR 252.00

ADAMTS15 Polyclonal Antibody
E-AB-10171-120uL	Elabscience Biotechnology	120uL	EUR 257.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3 Purified by: Affinity purification Background: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) Show more
Description: Rabbit antibody against Human,Mouse ADAMTS15 for IHC,ELISA applications.

ADAMTS15 Polyclonal Antibody
E-AB-10171-20uL	Elabscience Biotechnology	20uL	EUR 130.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3 Purified by: Affinity purification Background: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) Show more
Description: Rabbit antibody against Human,Mouse ADAMTS15 for IHC,ELISA applications.

ADAMTS15 Polyclonal Antibody
E-AB-10171-60uL	Elabscience Biotechnology	60uL	EUR 175.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3 Purified by: Affinity purification Background: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) Show more
Description: Rabbit antibody against Human,Mouse ADAMTS15 for IHC,ELISA applications.

ADAMTS15 Polyclonal Antibody
A70063	EpiGentek	100 ?g	EUR 628.55
Description: kits suitable for this type of research

ADAMTS15 Conjugated Antibody
C35644	SAB	100ul	EUR 397.00

ADAMTS15 cloning plasmid
CSB-CL837445HU-10ug	Cusabio	10ug	EUR 909.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2853 Sequence: ATGCTTCTGCTGGGCATCCTAACCCTGGCTTTCGCCGGGCGAACCGCTGGAGGCTCTGAGCCAGAGCGGGAGGTAGTCGTTCCCATCCGACTGGACCCGGACATTAACGGCCGCCGCTACTACTGGCGGGGTCCCGAGGACTCCGGGGATCAGGGACTCATTTTTCAGATCACAG Show more
Description: A cloning plasmid for the ADAMTS15 gene.

anti-Anti-ADAMTS15
YF-PA26950	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to Anti-ADAMTS15

Human ADAMTS15 shRNA Plasmid
20-abx966122	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse ADAMTS15 shRNA Plasmid
20-abx982182	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ADAMTS15 Antibody, HRP conjugated
1-CSB-PA837445LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADAMTS15 Antibody, FITC conjugated
1-CSB-PA837445LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADAMTS15 Antibody, Biotin conjugated
1-CSB-PA837445LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Adamts15 ELISA KIT
ELI-11462m	Lifescience Market	96 Tests	EUR 865.00

Human ADAMTS15 ELISA KIT
ELI-24449h	Lifescience Market	96 Tests	EUR 824.00

ADAMTS15 Polyclonal Antibody, HRP Conjugated
A70064	EpiGentek	100 ?g	EUR 628.55
Description: fast delivery possible

ADAMTS15 Polyclonal Antibody, FITC Conjugated
A70065	EpiGentek	100 ?g	EUR 628.55
Description: reagents widely cited

ADAMTS15 Polyclonal Antibody, Biotin Conjugated
A70066	EpiGentek	100 ?g	EUR 628.55
Description: Ask the seller for details

ADAMTS15 ORF Vector (Human) (pORF)
ORF012152	ABM	1.0 ug DNA	EUR 354.00

Adamts15 ORF Vector (Rat) (pORF)
ORF063065	ABM	1.0 ug DNA	EUR 506.00

Adamts15 ORF Vector (Mouse) (pORF)
ORF038101	ABM	1.0 ug DNA	EUR 506.00

ADAMTS15 sgRNA CRISPR Lentivector set (Human)
K0044901	ABM	3 x 1.0 ug	EUR 339.00

Adamts15 sgRNA CRISPR Lentivector set (Rat)
K6380501	ABM	3 x 1.0 ug	EUR 339.00

Adamts15 sgRNA CRISPR Lentivector set (Mouse)
K3586201	ABM	3 x 1.0 ug	EUR 339.00

ADAMTS15 Protein Vector (Mouse) (pPB-C-His)
PV152402	ABM	500 ng	EUR 1065.00

ADAMTS15 Protein Vector (Mouse) (pPB-N-His)
PV152403	ABM	500 ng	EUR 1065.00

ADAMTS15 Protein Vector (Mouse) (pPM-C-HA)
PV152404	ABM	500 ng	EUR 1065.00

ADAMTS15 Protein Vector (Mouse) (pPM-C-His)
PV152405	ABM	500 ng	EUR 1065.00

ADAMTS15 Protein Vector (Human) (pPB-C-His)
PV048605	ABM	500 ng	EUR 481.00

ADAMTS15 Protein Vector (Human) (pPB-N-His)
PV048606	ABM	500 ng	EUR 481.00

ADAMTS15 Protein Vector (Human) (pPM-C-HA)
PV048607	ABM	500 ng	EUR 481.00

ADAMTS15 Protein Vector (Human) (pPM-C-His)
PV048608	ABM	500 ng	EUR 481.00

ADAMTS15 sgRNA CRISPR Lentivector (Human) (Target 1)
K0044902	ABM	1.0 ug DNA	EUR 154.00

ADAMTS15 sgRNA CRISPR Lentivector (Human) (Target 2)
K0044903	ABM	1.0 ug DNA	EUR 154.00

ADAMTS15 sgRNA CRISPR Lentivector (Human) (Target 3)
K0044904	ABM	1.0 ug DNA	EUR 154.00

Adamts15 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6380502	ABM	1.0 ug DNA	EUR 154.00

Adamts15 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6380503	ABM	1.0 ug DNA	EUR 154.00

Adamts15 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6380504	ABM	1.0 ug DNA	EUR 154.00

Adamts15 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3586202	ABM	1.0 ug DNA	EUR 154.00

Adamts15 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3586203	ABM	1.0 ug DNA	EUR 154.00

Adamts15 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3586204	ABM	1.0 ug DNA	EUR 154.00

ADAMTS15 3'UTR Luciferase Stable Cell Line
TU000329	ABM	1.0 ml	EUR 2333.00

ADAMTS15 3'UTR GFP Stable Cell Line
TU050329	ABM	1.0 ml	EUR 2333.00

ADAMTS15 Protein Vector (Human) (pPB-His-MBP)
PV319854	ABM	500 ng	EUR 481.00

ADAMTS15 Protein Vector (Human) (pPB-His-GST)
PV319855	ABM	500 ng	EUR 481.00

ADAMTS15 Protein Vector (Rat) (pPB-C-His)
PV252258	ABM	500 ng	EUR 1191.00

ADAMTS15 Protein Vector (Rat) (pPB-N-His)
PV252259	ABM	500 ng	EUR 1191.00

ADAMTS15 Protein Vector (Rat) (pPM-C-HA)
PV252260	ABM	500 ng	EUR 1191.00

ADAMTS15 Protein Vector (Rat) (pPM-C-His)
PV252261	ABM	500 ng	EUR 1191.00

Adamts15 3'UTR GFP Stable Cell Line
TU250275	ABM	1.0 ml	Ask for price

Adamts15 3'UTR Luciferase Stable Cell Line
TU200275	ABM	1.0 ml	Ask for price

Adamts15 3'UTR GFP Stable Cell Line
TU151390	ABM	1.0 ml	Ask for price

Adamts15 3'UTR Luciferase Stable Cell Line
TU101390	ABM	1.0 ml	Ask for price

ADAMTS15 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV649561	ABM	1.0 ug DNA	EUR 1355.00

ADAMTS15 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV649565	ABM	1.0 ug DNA	EUR 1355.00

ADAMTS15 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV649566	ABM	1.0 ug DNA	EUR 1355.00

ADAMTS15 Protein Vector (Human) (pPM-N-D-C-HA)
PV319856	ABM	500 ng	EUR 481.00

ADAMTS15 Protein Vector (Human) (pPM-N-D-C-His)
PV319857	ABM	500 ng	EUR 481.00

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 15 (ADAMTS15) Antibody
20-abx212035	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 15 (ADAMTS15) Antibody
20-abx212386	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 15 (ADAMTS15) Antibody
20-abx212831	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 15 (ADAMTS15) Antibody
20-abx334251	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ADAMTS15 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0044905	ABM	3 x 1.0 ug	EUR 376.00

Adamts15 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6380505	ABM	3 x 1.0 ug	EUR 376.00

Adamts15 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3586205	ABM	3 x 1.0 ug	EUR 376.00

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 15 (ADAMTS15) Antibody (HRP)
20-abx334527	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 15 (ADAMTS15) Antibody (FITC)
20-abx334528	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 15 (ADAMTS15) Antibody (Biotin)
20-abx334529	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ADAMTS15 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0044906	ABM	1.0 ug DNA	EUR 167.00

ADAMTS15 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0044907	ABM	1.0 ug DNA	EUR 167.00

ADAMTS15 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0044908	ABM	1.0 ug DNA	EUR 167.00

ADAMTS15 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV649562	ABM	1.0 ug DNA	EUR 1355.00

ADAMTS15 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV649563	ABM	1.0 ug DNA	EUR 1413.00

ADAMTS15 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV649564	ABM	1.0 ug DNA	EUR 1413.00

Adamts15 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6380506	ABM	1.0 ug DNA	EUR 167.00

Adamts15 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6380507	ABM	1.0 ug DNA	EUR 167.00

Adamts15 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6380508	ABM	1.0 ug DNA	EUR 167.00

Adamts15 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3586206	ABM	1.0 ug DNA	EUR 167.00

Adamts15 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3586207	ABM	1.0 ug DNA	EUR 167.00

Adamts15 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3586208	ABM	1.0 ug DNA	EUR 167.00

Human A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E01A0932-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E01A0932-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E01A0932-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E02A0932-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E02A0932-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E02A0932-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E03A0932-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E03A0932-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E03A0932-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E06A0932-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E06A0932-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E06A0932-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E07A0932-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E07A0932-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E07A0932-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E04A0932-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E04A0932-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E04A0932-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E08A0932-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E08A0932-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E08A0932-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E09A0932-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E09A0932-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E09A0932-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E05A0932-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E05A0932-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit
E05A0932-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Based on the results obtained, a high analytical sensitivity (1×10³ microbe cells/ml) and specificity (100%) of PCR-RT with the developed reagent kit were established, regardless of the type of material being studied. The diagnostic sensitivity of PCR-RT using a set of reagents was at least 98.0% and specificity at least 99%.