[Assessment of the possibility of application in laboratory practice of reagent kit for diagnosis of glanders and melioidosis by real-time polymerase chain reaction.]

The reagent kit AmpligenBurk-mallei/pseudomallei-RT PCR is designed for detecting in vitro diagnostics and differentiate the DNA of glanders and melioidosis pathogens by real-time multiplex PCR in biological (clinical) material and cultures of microorganisms, as well as environmental objects and solid food products (rice). During clinical testing diagnostic value of reagent kit AmpligenBurk-mallei/pseudomallei-RT PCR has been studied.

ADAMTS15 Antibody

1-CSB-PA582168
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

ADAMTS15 Antibody

1-CSB-PA139279
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

ADAMTS15 Antibody

1-CSB-PA057722
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

ADAMTS15 Antibody

1-CSB-PA837445LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

ADAMTS15 Antibody

35644-100ul 100ul
EUR 252.00

ADAMTS15 Polyclonal Antibody

E-AB-10171-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs)
  • Show more
Description: Rabbit antibody against Human,Mouse ADAMTS15 for IHC,ELISA applications.

ADAMTS15 Polyclonal Antibody

E-AB-10171-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs)
  • Show more
Description: Rabbit antibody against Human,Mouse ADAMTS15 for IHC,ELISA applications.

ADAMTS15 Polyclonal Antibody

E-AB-10171-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs)
  • Show more
Description: Rabbit antibody against Human,Mouse ADAMTS15 for IHC,ELISA applications.

ADAMTS15 Polyclonal Antibody

A70063 100 ?g
EUR 628.55
Description: kits suitable for this type of research

ADAMTS15 Conjugated Antibody

C35644 100ul
EUR 397.00

ADAMTS15 cloning plasmid

CSB-CL837445HU-10ug 10ug
EUR 909.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2853
  • Sequence: ATGCTTCTGCTGGGCATCCTAACCCTGGCTTTCGCCGGGCGAACCGCTGGAGGCTCTGAGCCAGAGCGGGAGGTAGTCGTTCCCATCCGACTGGACCCGGACATTAACGGCCGCCGCTACTACTGGCGGGGTCCCGAGGACTCCGGGGATCAGGGACTCATTTTTCAGATCACAG
  • Show more
Description: A cloning plasmid for the ADAMTS15 gene.

anti-Anti-ADAMTS15

YF-PA26950 50 ul
EUR 334.00
Description: Mouse polyclonal to Anti-ADAMTS15

Human ADAMTS15 shRNA Plasmid

20-abx966122
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ADAMTS15 shRNA Plasmid

20-abx982182
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADAMTS15 Antibody, HRP conjugated

1-CSB-PA837445LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADAMTS15 Antibody, FITC conjugated

1-CSB-PA837445LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADAMTS15 Antibody, Biotin conjugated

1-CSB-PA837445LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Adamts15 ELISA KIT

ELI-11462m 96 Tests
EUR 865.00

Human ADAMTS15 ELISA KIT

ELI-24449h 96 Tests
EUR 824.00

ADAMTS15 Polyclonal Antibody, HRP Conjugated

A70064 100 ?g
EUR 628.55
Description: fast delivery possible

ADAMTS15 Polyclonal Antibody, FITC Conjugated

A70065 100 ?g
EUR 628.55
Description: reagents widely cited

ADAMTS15 Polyclonal Antibody, Biotin Conjugated

A70066 100 ?g
EUR 628.55
Description: Ask the seller for details

ADAMTS15 ORF Vector (Human) (pORF)

ORF012152 1.0 ug DNA
EUR 354.00

Adamts15 ORF Vector (Rat) (pORF)

ORF063065 1.0 ug DNA
EUR 506.00

Adamts15 ORF Vector (Mouse) (pORF)

ORF038101 1.0 ug DNA
EUR 506.00

ADAMTS15 sgRNA CRISPR Lentivector set (Human)

K0044901 3 x 1.0 ug
EUR 339.00

Adamts15 sgRNA CRISPR Lentivector set (Rat)

K6380501 3 x 1.0 ug
EUR 339.00

Adamts15 sgRNA CRISPR Lentivector set (Mouse)

K3586201 3 x 1.0 ug
EUR 339.00

ADAMTS15 Protein Vector (Mouse) (pPB-C-His)

PV152402 500 ng
EUR 1065.00

ADAMTS15 Protein Vector (Mouse) (pPB-N-His)

PV152403 500 ng
EUR 1065.00

ADAMTS15 Protein Vector (Mouse) (pPM-C-HA)

PV152404 500 ng
EUR 1065.00

ADAMTS15 Protein Vector (Mouse) (pPM-C-His)

PV152405 500 ng
EUR 1065.00

ADAMTS15 Protein Vector (Human) (pPB-C-His)

PV048605 500 ng
EUR 481.00

ADAMTS15 Protein Vector (Human) (pPB-N-His)

PV048606 500 ng
EUR 481.00

ADAMTS15 Protein Vector (Human) (pPM-C-HA)

PV048607 500 ng
EUR 481.00

ADAMTS15 Protein Vector (Human) (pPM-C-His)

PV048608 500 ng
EUR 481.00

ADAMTS15 sgRNA CRISPR Lentivector (Human) (Target 1)

K0044902 1.0 ug DNA
EUR 154.00

ADAMTS15 sgRNA CRISPR Lentivector (Human) (Target 2)

K0044903 1.0 ug DNA
EUR 154.00

ADAMTS15 sgRNA CRISPR Lentivector (Human) (Target 3)

K0044904 1.0 ug DNA
EUR 154.00

Adamts15 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6380502 1.0 ug DNA
EUR 154.00

Adamts15 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6380503 1.0 ug DNA
EUR 154.00

Adamts15 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6380504 1.0 ug DNA
EUR 154.00

Adamts15 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3586202 1.0 ug DNA
EUR 154.00

Adamts15 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3586203 1.0 ug DNA
EUR 154.00

Adamts15 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3586204 1.0 ug DNA
EUR 154.00

ADAMTS15 3'UTR Luciferase Stable Cell Line

TU000329 1.0 ml
EUR 2333.00

ADAMTS15 3'UTR GFP Stable Cell Line

TU050329 1.0 ml
EUR 2333.00

ADAMTS15 Protein Vector (Human) (pPB-His-MBP)

PV319854 500 ng
EUR 481.00

ADAMTS15 Protein Vector (Human) (pPB-His-GST)

PV319855 500 ng
EUR 481.00

ADAMTS15 Protein Vector (Rat) (pPB-C-His)

PV252258 500 ng
EUR 1191.00

ADAMTS15 Protein Vector (Rat) (pPB-N-His)

PV252259 500 ng
EUR 1191.00

ADAMTS15 Protein Vector (Rat) (pPM-C-HA)

PV252260 500 ng
EUR 1191.00

ADAMTS15 Protein Vector (Rat) (pPM-C-His)

PV252261 500 ng
EUR 1191.00

Adamts15 3'UTR GFP Stable Cell Line

TU250275 1.0 ml Ask for price

Adamts15 3'UTR Luciferase Stable Cell Line

TU200275 1.0 ml Ask for price

Adamts15 3'UTR GFP Stable Cell Line

TU151390 1.0 ml Ask for price

Adamts15 3'UTR Luciferase Stable Cell Line

TU101390 1.0 ml Ask for price

ADAMTS15 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV649561 1.0 ug DNA
EUR 1355.00

ADAMTS15 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV649565 1.0 ug DNA
EUR 1355.00

ADAMTS15 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV649566 1.0 ug DNA
EUR 1355.00

ADAMTS15 Protein Vector (Human) (pPM-N-D-C-HA)

PV319856 500 ng
EUR 481.00

ADAMTS15 Protein Vector (Human) (pPM-N-D-C-His)

PV319857 500 ng
EUR 481.00

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 15 (ADAMTS15) Antibody

20-abx212035
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 15 (ADAMTS15) Antibody

20-abx212386
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 15 (ADAMTS15) Antibody

20-abx212831
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 15 (ADAMTS15) Antibody

20-abx334251
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ADAMTS15 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0044905 3 x 1.0 ug
EUR 376.00

Adamts15 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6380505 3 x 1.0 ug
EUR 376.00

Adamts15 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3586205 3 x 1.0 ug
EUR 376.00

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 15 (ADAMTS15) Antibody (HRP)

20-abx334527
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 15 (ADAMTS15) Antibody (FITC)

20-abx334528
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 15 (ADAMTS15) Antibody (Biotin)

20-abx334529
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ADAMTS15 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0044906 1.0 ug DNA
EUR 167.00

ADAMTS15 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0044907 1.0 ug DNA
EUR 167.00

ADAMTS15 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0044908 1.0 ug DNA
EUR 167.00

ADAMTS15 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV649562 1.0 ug DNA
EUR 1355.00

ADAMTS15 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV649563 1.0 ug DNA
EUR 1413.00

ADAMTS15 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV649564 1.0 ug DNA
EUR 1413.00

Adamts15 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6380506 1.0 ug DNA
EUR 167.00

Adamts15 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6380507 1.0 ug DNA
EUR 167.00

Adamts15 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6380508 1.0 ug DNA
EUR 167.00

Adamts15 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3586206 1.0 ug DNA
EUR 167.00

Adamts15 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3586207 1.0 ug DNA
EUR 167.00

Adamts15 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3586208 1.0 ug DNA
EUR 167.00

Human A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E01A0932-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E01A0932-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E01A0932-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E02A0932-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E02A0932-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E02A0932-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E03A0932-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E03A0932-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E03A0932-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E06A0932-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E06A0932-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E06A0932-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E07A0932-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E07A0932-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E07A0932-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E04A0932-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E04A0932-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E04A0932-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E08A0932-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E08A0932-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E08A0932-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E09A0932-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E09A0932-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E09A0932-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E05A0932-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E05A0932-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) ELISA kit

E05A0932-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 15(ADAMTS15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Based on the results obtained, a high analytical sensitivity (1×103 microbe cells/ml) and specificity (100%) of PCR-RT with the developed reagent kit were established, regardless of the type of material being studied. The diagnostic sensitivity of PCR-RT using a set of reagents was at least 98.0% and specificity at least 99%.